Tomato miRNA M00154
sequence | Length | miRNA family | sRNA ID | target |
AUAAAAUUGAACAAUUAGACGGAC | 24 | NA |
S08777387
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3 | 0.4 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 10 | 0.74 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 35 | 14.64 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 9 | 9.2 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 32 | 8.05 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 106 | 30.04 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 145 | 37.1 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 154 | 74.18 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 92 | 76.43 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 144 | 81.65 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 233 | 71.89 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 398 | 104.49 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 5 | 1.5 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 6 | 1.82 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 4 | 1.21 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00154
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch06 | 43743862 | 43743962 | + |
AUAAAAUUGAACAAUUAGAC
GGACAUGACAUAAUAACGUA
GGAAGUCAUAUAGACACAAA
AUUUUCAUGUAUGACGAAUG
UGUCUAUCUGUUCAAUUUUA
U | -26.90 | NA |
structure |
|