Tomato miRNA M00163
sequence | Length | miRNA family | sRNA ID | target |
AAGAUAGACUUGUUUGACUCUUGA | 24 | NA |
S02465474
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 28 | 2.07 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 18 | 13.87 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 3 | 2.21 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 30 | 19.11 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 28 | 18.45 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 13 | 7.95 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 20 | 11.97 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 77 | 75.13 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 227 | 132.52 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 108 | 105.94 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 137 | 96.89 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 47 | 51.16 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 70 | 66.88 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5 | 14.44 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 23 | 16.02 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6 | 8.01 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1 | 0.28 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 13 | 7.37 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 25 | 7.71 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 65 | 17.06 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00163
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch03 | 23984834 | 23984651 | - |
UUAAGAGUCAAACAAUUUAA
GUUUGAUCGAAAAUUUGCGG
AUGGAAUCUUUAAUUUUUUU
AAAUGAAAUUUAUAUAUUUA
UAAACUGCAUAAAAGGUAUU
AUGAGUCAUAAUAAUGGAUA
AUUCUAAUUGUUUAAAAGAU
CUAUGAAUUAUUUACGGGCA
AAGAUAGACUUGUUUGACUC
UUGA | -39.60 | NA |
structure |
|