Tomato miRNA M00166
| sequence | Length | miRNA family | sRNA ID | target |
| ACAUGGACAAGUAAAUAGGGACGG | 24 | NA |
S04771485
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 8 | 0.78 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 6 | 0.44 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 67 | 28.02 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 137 | 140.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 108 | 27.18 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 334 | 94.66 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 146 | 37.35 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 24 | 11.56 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 9 | 5.1 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 28 | 8.64 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 36 | 9.45 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00166
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch09 | 40273619 | 40273488 | - |
ACAUGGACAAGUAAAUAGGG
ACGGGGAGUAUUUAAUAUUU
AUUUUGAGAUUAAAUUAAUU
CAGAUUAACAUAACAAAAGU
CCAGUCUUAAAAACGCUAAU
UAAUUCCUCUAUUCCUAAUU
UAUUUGUUCAGU | -30.30 | NA |
structure |
|