Tomato miRNA M00167
sequence | Length | miRNA family | sRNA ID | target |
UGGGCAGCGAACCGGAACUACGAG | 24 | NA |
S23805755
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 22 | 2.14 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 9 | 1.19 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 39 | 8.4 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3 | 0.22 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 175 | 134.86 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 9 | 6.83 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 90 | 64.12 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 110 | 81.01 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 140 | 87.42 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 61 | 38.86 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 54 | 35.59 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 89 | 54.41 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 116 | 69.44 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 10 | 9.76 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 20 | 11.68 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 13 | 12.75 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 20 | 14.14 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 58 | 63.14 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 3 | 8.67 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 100 | 69.66 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 105 | 140.12 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 9 | 3.76 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 7 | 7.16 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 35 | 9.92 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 18 | 4.61 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 31 | 14.93 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 24 | 19.94 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 22 | 12.47 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 14 | 4.32 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 23 | 6.04 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00167
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch08 | 54874177 | 54874098 | - |
CUCGUAGUUUCGAUUCGCUG
UCCAGAACCAGGCUAAGAAA
AAAAAUUACCUGGUUCUGGG
CAGCGAACCGGAACUACGAG
| -56.10 | NA |
structure |
|