Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00167

sequence	Length	miRNA family	sRNA ID	target
UGGGCAGCGAACCGGAACUACGAG	24	NA	S23805755	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	22	2.14
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	9	1.19
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	8	0.93
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	39	8.4
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	3	0.22
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	175	134.86
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	9	6.83
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	90	64.12
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	110	81.01
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	140	87.42
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	61	38.86
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	54	35.59
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	89	54.41
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	116	69.44
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	10	9.76
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	20	11.68
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	13	12.75
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	20	14.14
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	58	63.14
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	3	8.67
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	100	69.66
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	105	140.12
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	9	3.76
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	7	7.16
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	11	2.77
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	35	9.92
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	18	4.61
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	31	14.93
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	24	19.94
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	22	12.47
S0708	Solanum lycopersicum	MicroTom	flower, open	14	4.32
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	23	6.04
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3
S0371	Solanum lycopersicum	Heinz 1706	leaf	2	0.6

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00167

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch08	54874177	54874098	-	CUCGUAGUUUCGAUUCGCUG UCCAGAACCAGGCUAAGAAA AAAAAUUACCUGGUUCUGGG CAGCGAACCGGAACUACGAG	-56.10	NA	structure