Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00169

sequence	Length	miRNA family	sRNA ID	target
AGGCGCAUGUGUCAUAUCUUUACA	24	NA	S07733087	click here

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	3	0.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	17	2.25
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	99	11.57
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	35	7.54
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	686	50.6
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	15	11.56
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	13	9.86
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	12	8.55
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	6	4.42
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	14	8.74
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	13	8.28
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	29	19.11
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	8	4.89
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	11	6.58
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	48	46.83
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	54	31.52
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	61	59.84
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	63	44.56
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	64	69.67
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	169	161.47
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	7	20.22
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	30	20.9
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	7	9.34
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	22	9.2
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	29	7.3
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	42	11.9
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	52	13.3
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	26	12.52
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	12	9.97
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	37	20.98
S0708	Solanum lycopersicum	MicroTom	flower, open	386	119.1
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	119	31.24
S0373	Solanum lycopersicum	Heinz 1706	fruit	121	36.22
S0372	Solanum lycopersicum	Heinz 1706	flower	148	44.79
S0371	Solanum lycopersicum	Heinz 1706	leaf	31	9.34

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00169

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch09	1188165	1188098	-	AGGCGCAUGUGUCAUAUCUU UACAUGGUCUGACAUCUGAG ACCAUGUAAGGAUAUGACAC AUGAGCCC	-47.50	miRNA*	structure