Tomato miRNA M00169

sequenceLengthmiRNA familysRNA IDtarget
AGGCGCAUGUGUCAUAUCUUUACA24NA S07733087 click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)30.29
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)172.25
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)9911.57
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)357.54
S0735Solanum lycopersicumSunnyleaf , TSWV-infected68650.6
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 1511.56
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 139.86
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 128.55
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 64.42
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 148.74
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 138.28
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 2919.11
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 84.89
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 116.58
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate34846.83
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate25431.52
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate16159.84
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate26344.56
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate16469.67
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate2169161.47
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate1720.22
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate23020.9
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate179.34
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker229.2
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker297.3
S0713Solanum lycopersicumMicroTom fruit , breaker stage4211.9
S0712Solanum lycopersicumMicroTom fruit , mature green5213.3
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter2612.52
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter129.97
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter3720.98
S0708Solanum lycopersicumMicroTom flower, open386119.1
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming11931.24
S0373Solanum lycopersicumHeinz 1706fruit12136.22
S0372Solanum lycopersicumHeinz 1706flower14844.79
S0371Solanum lycopersicumHeinz 1706leaf319.34

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00169

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy
miRNA*structure
SL2.40ch0911881651188098- AGGCGCAUGUGUCAUAUCUU
UACA
UGGUCUGACAUCUGAG
ACCAUGUAAGGAUAUGACAC
AUGAGCCC
-47.50miRNA* structure