Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00170

sequence	Length	miRNA family	sRNA ID	target
AUAUGACGGCAGGAACAUCAAUGU	24	NA	S09954219	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	3	0.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	3	0.4
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2	0.43
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	9	0.66
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	205	157.98
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	179	135.79
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	194	138.21
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	221	162.76
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	176	109.9
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	194	123.59
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	250	164.76
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	254	155.28
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	161	96.38
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	15	14.64
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	54	31.52
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	1	0.98
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	41	29
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	26	28.3
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	120	83.6
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	77	102.75
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	41	17.14
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	102	104.3
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	50	12.59
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	145	41.1
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	53	13.56
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	26	12.52
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	7	5.82
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	51	28.92
S0708	Solanum lycopersicum	MicroTom	flower, open	85	26.23
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	150	39.38
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3
S0371	Solanum lycopersicum	Heinz 1706	leaf	3	0.9

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00170

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch06	39088176	39088284	+	ACAUUGGUGUCCCUGUCGUU CGUAAAUUAAAGCAUACAUG CCCUUUCACUCUAACAAAGU GGCAUGGGCACCAAAUGUCC CAAAAAUAUGACGGCAGGAA CAUCAAUGU	-41.56	NA	structure