Tomato miRNA M00171
sequence | Length | miRNA family | sRNA ID | target |
CAUGGCAGGAAGACAUGAGGCAUU | 24 | NA |
S13318188
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 167 | 128.69 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 63 | 47.79 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 73 | 52.01 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 103 | 75.86 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 172 | 107.4 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 134 | 85.36 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 97 | 63.93 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 153 | 93.54 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 287 | 171.8 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 43 | 41.96 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 169 | 98.66 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 44 | 43.16 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 104 | 73.55 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 18 | 19.59 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 109 | 75.93 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 94 | 125.44 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 11 | 11.25 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 13 | 3.27 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 15 | 4.25 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 33 | 8.44 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 121 | 58.29 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 102 | 84.74 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 164 | 92.99 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 36 | 11.11 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 263 | 69.04 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00171
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch04 | 4907566 | 4907643 | + |
CAUGGCAGGAAGACAUGAGG
CAUUAGUAUGUAUAUUGUGU
AAAUUUUAAAUACUAAUGCC
UCAUGCCUUCCUGCCAUG | -48.40 | NA |
structure |
|