 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00173
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AGAGACAAUACCUGAAUAUGUGAA | 24 | NA | S06434920 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4 | 0.39 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3 | 0.4 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 88 | 6.49 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 7 | 5.39 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 15 | 11.38 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 2 | 1.47 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 10 | 6.24 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 11 | 7.01 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 4 | 2.64 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 1 | 0.61 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 2 | 1.2 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 61 | 59.52 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 91 | 53.12 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 136 | 133.41 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 31 | 21.92 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 65 | 70.76 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 188 | 179.63 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 36 | 103.99 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 15 | 10.45 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 3 | 4 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 8 | 3.35 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 21 | 5.29 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 13 | 3.68 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 32 | 8.19 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 6 | 4.98 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 15 | 8.51 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 47 | 14.5 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 27 | 7.09 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 29 | 8.78 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 18 | 5.42 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00173
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 49238943 | 49238747 | - | UCCACAUACUCAGGUAUUGU CUCUGCCAUGGGCGGCCAUU CGCUCUUUUAAUCCCCUCUU AUUGGCUCGCAGCCUCAAGG GAGAAUCGAACCCGUGACCU AUGGCUCCUUUACAUUCCCU UGAGGCAGCAAGCCAAUAAG AGGGGAUUAAAAGAGCGAAU GGCCGCCAAUGGCAGAGACA AUACCUGAAUAUGUGAA | -149.27 | NA | structure |
