Tomato miRNA M00174
| sequence | Length | miRNA family | sRNA ID | target |
| UGGACGGCGAGGACAUGAGUGAAC | 24 | NA |
S23636861
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 241 | 185.72 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 173 | 131.24 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 142 | 101.17 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 140 | 103.11 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 143 | 89.29 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 157 | 100.02 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 153 | 100.83 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 200 | 122.27 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 290 | 173.6 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 14 | 13.66 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 31 | 18.1 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 20 | 19.62 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 18 | 12.73 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 52 | 56.61 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 65 | 62.1 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 18 | 52 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 131 | 91.26 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 124 | 165.47 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 9 | 3.76 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 15 | 15.34 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 30 | 7.55 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 43 | 12.19 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 50 | 12.79 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 63 | 30.35 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 35 | 29.08 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 52 | 29.48 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 18 | 5.55 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 86 | 22.58 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00174
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch02 | 33638943 | 33638831 | - |
GUUCACUCAUGUUUUCGCCA
UCCAACUUUUGGUUCAUGUA
UGUCCAACAUGGCAACUAAC
GCCUAUAAAGGCAUAUUUGC
ACCAAAAGUUGGACGGCGAG
GACAUGAGUGAAC | -67.40 | NA |
structure |
|