Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00174

sequence	Length	miRNA family	sRNA ID	target
UGGACGGCGAGGACAUGAGUGAAC	24	NA	S23636861	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	241	185.72
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	173	131.24
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	142	101.17
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	140	103.11
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	143	89.29
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	157	100.02
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	153	100.83
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	200	122.27
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	290	173.6
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	14	13.66
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	31	18.1
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	20	19.62
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	18	12.73
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	52	56.61
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	65	62.1
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	18	52
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	131	91.26
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	124	165.47
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	9	3.76
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	15	15.34
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	30	7.55
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	43	12.19
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	50	12.79
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	63	30.35
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	35	29.08
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	52	29.48
S0708	Solanum lycopersicum	MicroTom	flower, open	18	5.55
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	86	22.58

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00174

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch02	33638943	33638831	-	GUUCACUCAUGUUUUCGCCA UCCAACUUUUGGUUCAUGUA UGUCCAACAUGGCAACUAAC GCCUAUAAAGGCAUAUUUGC ACCAAAAGUUGGACGGCGAG GACAUGAGUGAAC	-67.40	NA	structure