Tomato miRNA M00176
sequence | Length | miRNA family | sRNA ID | target |
AUGGCAGAGACAAUACCUGAGUAU | 24 | NA |
S11184187
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 13 | 0.96 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 34 | 26.2 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 20 | 15.17 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 6 | 4.27 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 21 | 15.47 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 18 | 11.24 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 15 | 9.56 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 22 | 13.45 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 10 | 5.99 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 125 | 121.96 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 255 | 148.86 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 117 | 114.77 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 185 | 130.84 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 56 | 60.96 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 126 | 120.39 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 66 | 190.66 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 4 | 5.34 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 12 | 3.02 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 19 | 5.39 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 23 | 5.88 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 18 | 8.67 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 9 | 7.48 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 50 | 15.43 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 57 | 14.96 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 5 | 1.51 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00176
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch02 | 49238752 | 49238938 | + |
AUAUUCAGGUAUUGUCUCUG
CCAUUGGCGGCCAUUCGCUC
UUUUAAUCCCCUCUUAUUGG
CUUGCUGCCUCAAGGGAAUG
UAAAGGAGCCAUAGGUCACG
GGUUCGAUUCUCCCUUGAGG
CUGCGAGCCAAUAAGAGGGG
AUUAAAAGAGCGAAUGGCCG
CCCAUGGCAGAGACAAUACC
UGAGUAU | -154.30 | NA |
structure |
|