Tomato miRNA M00177
| sequence | Length | miRNA family | sRNA ID | target |
|---|
| AGAAUAGUUGGCUCAUUAGGUUAA | 24 | NA |
S06121010
| NA |
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 41 | 4.79 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 6 | 1.29 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 69 | 5.09 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 2 | 1.54 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 1 | 0.76 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 7 | 5.16 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 2 | 1.25 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 6 | 3.82 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 6 | 3.95 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 42 | 40.98 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 41 | 23.93 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 10 | 7.07 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 55 | 59.87 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 208 | 198.73 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 10 | 28.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 3 | 0.76 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 4 | 1.02 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 72 | 22.22 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 13 | 3.41 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 16 | 4.79 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 28 | 8.47 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 26 | 7.83 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00177
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand | sequence |
folding
energy | miRNA* | structure |
|---|
| SL2.40ch03 | 63515431 | 63515513 | + |
UUAGCUUAAUGAACAAGCUA
UUCUUUAAUUAGGGAAUCGA
AAACCAAUUUCCUAUUUAAA
GAAUAGUUGGCUCAUUAGGU
UAA | -35.30 | NA |
structure |
|
