Tomato miRNA M00182
sequence | Length | miRNA family | sRNA ID | target |
AGACAAGCAAAUUGAAACGGACUG | 24 | NA |
S06206896
| NA |
Digital expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4 | 0.39 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 4 | 0.53 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 173 | 12.76 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 302 | 232.73 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 137 | 103.93 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 113 | 80.51 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 151 | 111.21 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 181 | 113.02 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 191 | 121.68 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 153 | 100.83 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 140 | 85.59 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 212 | 126.91 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 13 | 12.68 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 30 | 17.51 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 38 | 26.87 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 77 | 83.82 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 2 | 1.91 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 140 | 97.53 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 19 | 25.35 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 8 | 2.27 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 10 | 2.56 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 7 | 3.37 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 18 | 5.55 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 16 | 4.2 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 15 | 4.54 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 11 | 3.31 |
Hits on known miRNAs
No hits on known miRNAs were found |
Precursor of miRNA M00182
genome hit of precursor | precursor |
sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
SL2.40ch06 | 36014894 | 36015050 | + |
CCUCUGUUUCAAUUUGUUUG
UCUGGCUUUGACAUGACACA
AAGUUUAGGAAAGUAAAAAA
UACUUUUGAAUCUUGUGAUC
UUAAACAUGUCACGUGAAAA
GUUGAAAUUAAAGAGUUGCA
AAAAAGGAAAGUAAGACAAG
CAAAUUGAAACGGACUG | -49.30 | NA |
structure |
|