Tomato miRNA M00188

sequenceLengthmiRNA familysRNA IDtarget
UUUCGGACAUAGGUUGAGAGGGUA24NA S26186096 click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)20.19
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)20.27
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)60.7
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)102.15
S0735Solanum lycopersicumSunnyleaf , TSWV-infected14410.62
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 340262.01
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 298226.06
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 279198.77
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 243178.96
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 291181.7
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 309196.85
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 314206.94
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 680415.72
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 416249.02
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate34442.93
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate29153.12
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate13130.41
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate24733.24
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate1117127.37
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate27874.53
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate1926
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate2354246.61
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate1110146.79
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker4016.73
S0715Solanum lycopersicumMicroTom fruit , 5 days post breaker4343.97
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker9824.67
S0713Solanum lycopersicumMicroTom fruit , breaker stage16847.62
S0712Solanum lycopersicumMicroTom fruit , mature green12632.24
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter8842.39
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter3529.08
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter2715.31
S0708Solanum lycopersicumMicroTom flower, open12739.19
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming6116.01
S0373Solanum lycopersicumHeinz 1706fruit102.99
S0372Solanum lycopersicumHeinz 1706flower72.12
S0371Solanum lycopersicumHeinz 1706leaf92.71

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00188

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy
miRNA*structure
SL2.40ch0515078341507718- UACCCCCUUAAUCUAUGCCA
GAAAUCUCAGAGACACUUAU
ACUAUACUAAGGGGGUAAUA
GGACCACAAUAUAGUAUAAG
UGUGUCUCUGAGAUUUCGGA
CAUAGGUUGAGAGGGUA
-61.70NA structure