Tomato miRNA M00189
| sequence | Length | miRNA family | sRNA ID | target |
| AAGGGAUUGUAGGCAGAGAGAUGG | 24 | NA |
S02840588
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 24 | 1.77 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 163 | 125.61 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 23 | 17.45 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 93 | 66.26 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 122 | 89.85 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 139 | 86.79 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 65 | 41.41 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 93 | 61.29 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 164 | 100.26 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 174 | 104.16 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 37 | 36.1 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 34 | 19.85 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 17 | 16.68 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 50 | 35.36 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 62 | 67.49 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 35 | 33.44 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 21 | 60.66 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 21 | 14.63 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 72 | 96.08 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 15 | 6.27 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 24 | 6.04 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 77 | 21.82 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 48 | 12.28 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 187 | 90.08 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 351 | 291.59 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 738 | 418.45 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 75 | 23.14 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 172 | 45.15 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00189
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch02 | 45487029 | 45487198 | + |
CCAUCUUCCUGGCUAUAUUC
CCUUGUAAAGUGUCCCUCUU
CGCCGCAUUUGUAGCAUCCC
GCUAUUCCUCCACCGCCUCC
CUGGCUACAUUCCCUUGCGA
AAGAAGGAGGGGGCUGCUAC
AAAUGUGGGGAAGAAGGGCA
UUUUGGAAGGGAUUGUAGGC
AGAGAGAUGG | -98.30 | NA |
structure |
| SL2.40ch02 | 45483332 | 45483501 | + |
CCAUCUUCCUGGCUAUAUUC
CCUUGUAAAGUGUCCUUCUU
GUCCGCAUUUGUAGCAUCCC
GCUCCUCCUCCACCGCCUCC
UUGGCUACAUUCCCUUGUGA
AAGAAGGAAGGGGCUGCUAC
AAAUGUGGGGAAGAAGGGCA
UUUUGGAAGGGAUUGUAGGC
AGAGAGAUGG | -98.80 | NA |
structure |
|