Tomato miRNA M00190
| sequence | Length | miRNA family | sRNA ID | target |
| UGUGGGGAAGAAGGGCAUUUUGGA | 24 | NA |
S24119684
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 7 | 0.93 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 51 | 3.76 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 12 | 9.25 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 3 | 2.28 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 12 | 8.55 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 12 | 7.49 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 7 | 4.46 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 10 | 6.59 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 15 | 9.17 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 5 | 2.99 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 18 | 17.56 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 3 | 1.75 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 9 | 6.37 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 7 | 7.62 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3 | 2.87 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 7 | 4.88 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 15 | 20.02 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 9 | 3.76 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 30 | 7.55 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 68 | 19.27 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 17 | 4.35 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 74 | 35.65 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 318 | 264.18 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 743 | 421.28 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 18 | 5.55 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 22 | 5.78 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00190
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch02 | 45487052 | 45487175 | + |
UGUAAAGUGUCCCUCUUCGC
CGCAUUUGUAGCAUCCCGCU
AUUCCUCCACCGCCUCCCUG
GCUACAUUCCCUUGCGAAAG
AAGGAGGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGA | -63.50 | NA |
structure |
| SL2.40ch02 | 45483355 | 45483478 | + |
UGUAAAGUGUCCUUCUUGUC
CGCAUUUGUAGCAUCCCGCU
CCUCCUCCACCGCCUCCUUG
GCUACAUUCCCUUGUGAAAG
AAGGAAGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGA | -64.00 | NA |
structure |
|