Tomato miRNA M00195

sequenceLengthmiRNA familysRNA IDtarget
AGGAAGACAUGAGGCAUUAGUAUG24NA S07391143 NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)10.13
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)20.23
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)10.22
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 450346.78
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 150113.79
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 156111.14
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 157115.63
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 367229.16
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 518329.99
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 314206.94
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 445272.05
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 672402.27
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate3127123.91
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate2647377.7
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate1146143.22
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate2338239.04
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate16570.76
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate243.82
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate112.89
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate2594413.8
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate1499665.88
S0715Solanum lycopersicumMicroTom fruit , 5 days post breaker11.02
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker41.01
S0713Solanum lycopersicumMicroTom fruit , breaker stage51.42
S0712Solanum lycopersicumMicroTom fruit , mature green92.3
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter14971.77
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter7763.97
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter13073.71
S0708Solanum lycopersicumMicroTom flower, open13441.34
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming507133.1
S0372Solanum lycopersicumHeinz 1706flower10.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00195

genome hit of precursorprecursor
sequence IDstartendstrandsequence folding
energy
miRNA*structure
SL2.40ch0449075724907637+ AGGAAGACAUGAGGCAUUAG
UAUG
UAUAUUGUGUAAAUUU
UAAAUACUAAUGCCUCAUGC
CUUCCU
-33.80NA structure