Tomato miRNA M00195
| sequence | Length | miRNA family | sRNA ID | target |
| AGGAAGACAUGAGGCAUUAGUAUG | 24 | NA |
S07391143
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 450 | 346.78 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 150 | 113.79 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 156 | 111.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 157 | 115.63 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 367 | 229.16 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 518 | 329.99 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 314 | 206.94 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 445 | 272.05 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 672 | 402.27 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 127 | 123.91 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 647 | 377.7 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 146 | 143.22 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 338 | 239.04 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 65 | 70.76 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 4 | 3.82 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 594 | 413.8 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 499 | 665.88 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 1 | 1.02 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 4 | 1.01 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 5 | 1.42 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 9 | 2.3 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 149 | 71.77 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 77 | 63.97 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 130 | 73.71 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 134 | 41.34 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 507 | 133.1 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00195
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch04 | 4907572 | 4907637 | + |
AGGAAGACAUGAGGCAUUAG
UAUGUAUAUUGUGUAAAUUU
UAAAUACUAAUGCCUCAUGC
CUUCCU | -33.80 | NA |
structure |
|