Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00195

sequence	Length	miRNA family	sRNA ID	target
AGGAAGACAUGAGGCAUUAGUAUG	24	NA	S07391143	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	450	346.78
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	150	113.79
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	156	111.14
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	157	115.63
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	367	229.16
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	518	329.99
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	314	206.94
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	445	272.05
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	672	402.27
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	127	123.91
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	647	377.7
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	146	143.22
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	338	239.04
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	65	70.76
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	4	3.82
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	1	2.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	594	413.8
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	499	665.88
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	1	1.02
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	4	1.01
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	5	1.42
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	9	2.3
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	149	71.77
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	77	63.97
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	130	73.71
S0708	Solanum lycopersicum	MicroTom	flower, open	134	41.34
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	507	133.1
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00195

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch04	4907572	4907637	+	AGGAAGACAUGAGGCAUUAG UAUGUAUAUUGUGUAAAUUU UAAAUACUAAUGCCUCAUGC CUUCCU	-33.80	NA	structure