Tomato miRNA M00197
| sequence | Length | miRNA family | sRNA ID | target |
| AUGGCAGAGACAAUACCUGAAUAU | 24 | NA |
S11184180
| NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 26 | 1.92 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 69 | 53.17 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 127 | 96.34 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 28 | 19.95 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 53 | 39.03 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 57 | 35.59 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 80 | 50.96 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 60 | 39.54 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 89 | 54.41 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 63 | 37.71 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 735 | 717.14 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 874 | 510.22 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 931 | 913.25 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 839 | 593.37 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 407 | 443.06 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 849 | 811.18 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 278 | 803.07 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 17 | 11.84 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 29 | 38.7 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 8 | 3.35 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 19 | 4.78 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 15 | 3.84 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 17 | 8.19 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 10 | 5.67 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 60 | 18.51 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 90 | 23.63 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 10 | 3.03 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 9 | 2.71 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00197
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch02 | 49238938 | 49238752 | - |
AUACUCAGGUAUUGUCUCUG
CCAUGGGCGGCCAUUCGCUC
UUUUAAUCCCCUCUUAUUGG
CUCGCAGCCUCAAGGGAGAA
UCGAACCCGUGACCUAUGGC
UCCUUUACAUUCCCUUGAGG
CAGCAAGCCAAUAAGAGGGG
AUUAAAAGAGCGAAUGGCCG
CCAAUGGCAGAGACAAUACC
UGAAUAU | -141.17 | NA |
structure |
|