Tomato miRNA M00198
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 475 | 46.29 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 531 | 70.38 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 132 | 15.42 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 60 | 12.92 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 8398 | 619.44 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 246 | 102.87 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 37 | 37.83 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 998 | 251.2 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 774 | 219.37 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2247 | 574.87 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 939 | 452.31 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 439 | 364.69 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2136 | 1211.12 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2134 | 658.43 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 3240 | 850.59 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3308 | 990.13 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4498 | 1361.28 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2806 | 845.56 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00198
| genome hit of precursor | precursor |
| sequence ID | start | end | strand | sequence |
folding energy | miRNA* | structure |
| SL2.40ch01 | 831472 | 831535 | + |
GGUUCAAUUUGUUUGCCCUA
CUUUACUUUUAAAGUAAAGU
AAAGUGAGACGAACAAAUUG
AAUC | -28.40 | NA |
structure |
|