Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00201

sequence	Length	miRNA family	sRNA ID	target
AGAGGCGGAGUCAGAAUUUUCAAU	24	NA	S06648170	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2	0.19
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	22	2.92
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	12	1.4
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	4	0.86
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	264	19.47
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	1070	824.56
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	1284	974.05
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	1971	1404.21
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	2830	2084.23
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	1761	1099.58
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	1337	851.73
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	1989	1310.85
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	1286	786.19
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	1443	863.8
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	246	240.02
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	283	165.21
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	277	271.72
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	525	371.3
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	839	913.34
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	1390	1328.08
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	771	2227.21
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	2993	2085.05
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	2537	3385.46
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	800	334.53
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	215	219.85
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	1254	315.64
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	1438	407.56
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	1379	352.8
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	479	230.73
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	318	264.18
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	559	316.95
S0708	Solanum lycopersicum	MicroTom	flower, open	312	96.27
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	572	150.17
S0373	Solanum lycopersicum	Heinz 1706	fruit	24	7.18
S0372	Solanum lycopersicum	Heinz 1706	flower	31	9.38
S0371	Solanum lycopersicum	Heinz 1706	leaf	16	4.82

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00201

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch12	6710898	6711056	+	AGAGGCGGAGUCAGAAUUUU CAAUAAGGGGUUCAAAAUCU GUAGAUAUAGAUAGUCAAAG AGGGUUCGACAUCUACUAUA AACUUAUUUUAACCAUGUAC AAUUAAUAUAAUUUUCCUCC GAAGGGAACCCCUUGUAUGA AGGUAGCUCCUCCGCCCCU	-45.40	NA	structure