Tomato sRNA S00324760
| Sequence | Length | annotation |
| AAAAGCUGACGGCGUUAGAUUGAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 15 | 1.11 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 131 | 100.95 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 53 | 40.21 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 62 | 44.17 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 65 | 47.87 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 79 | 49.33 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 71 | 45.23 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 62 | 40.86 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 83 | 50.74 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 76 | 45.49 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 104 | 101.47 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 151 | 88.15 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 77 | 75.53 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 171 | 120.94 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 75 | 81.65 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 144 | 137.59 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 71 | 205.1 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 62 | 43.19 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 44 | 58.72 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 7 | 2.93 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 16 | 4.03 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 32 | 9.07 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 45 | 11.51 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 15 | 7.23 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 22 | 18.28 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 18 | 10.21 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 108 | 33.32 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 210 | 55.13 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
|