Tomato Functional Genomics Database (TFGD)

Tomato sRNA S00324760

Sequence	Length	annotation
AAAAGCUGACGGCGUUAGAUUGAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	15	1.11
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	131	100.95
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	53	40.21
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	62	44.17
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	65	47.87
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	79	49.33
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	71	45.23
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	62	40.86
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	83	50.74
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	76	45.49
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	104	101.47
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	151	88.15
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	77	75.53
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	171	120.94
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	75	81.65
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	144	137.59
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	71	205.1
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	62	43.19
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	44	58.72
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	5	5.11
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	16	4.03
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	32	9.07
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	45	11.51
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	15	7.23
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	22	18.28
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	18	10.21
S0708	Solanum lycopersicum	MicroTom	flower, open	108	33.32
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	210	55.13
S0371	Solanum lycopersicum	Heinz 1706	leaf	2	0.6