Tomato Functional Genomics Database (TFGD)

Tomato sRNA S00474604

Sequence	Length	annotation
AAAAUGAUCAUUAGCGGCAUUUAA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	76	5.61
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	111	85.54
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	78	59.17
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	46	32.77
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	37	27.25
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	46	28.72
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	111	70.71
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	88	58
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	108	66.03
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	101	60.46
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	171	166.84
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	430	251.02
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	197	193.24
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	575	406.66
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	115	125.19
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	133	127.08
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	18	52
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	82	57.12
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	22	29.36
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	10	4.18
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	2	2.05
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	7	1.76
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	23	6.52
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	15	3.84
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	52	25.05
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	48	39.88
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	49	27.78
S0708	Solanum lycopersicum	MicroTom	flower, open	70	21.6
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	79	20.74
S0373	Solanum lycopersicum	Heinz 1706	fruit	4	1.2
S0372	Solanum lycopersicum	Heinz 1706	flower	4	1.21
S0371	Solanum lycopersicum	Heinz 1706	leaf	4	1.21