Tomato Functional Genomics Database (TFGD)

Tomato sRNA S00969667

Sequence	Length	annotation
AAAGCUGACGGCGUUAGAUUGAUA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	2	0.27
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	7	0.52
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	103	79.37
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	36	27.31
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	35	24.94
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	47	34.61
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	88	54.95
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	68	43.32
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	78	51.41
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	77	47.07
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	74	44.3
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	153	149.28
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	252	147.11
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	161	157.93
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	247	174.69
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	60	65.32
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	134	128.03
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	82	236.88
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	33	22.99
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	43	57.38
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	12	5.02
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	13	13.29
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	7	1.76
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	23	6.52
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	23	5.88
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	13	6.26
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	5	4.15
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	15	8.51
S0708	Solanum lycopersicum	MicroTom	flower, open	52	16.04
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	132	34.65
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3