Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AAAGUGAGACGAACAAAUUGAAUC	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	475	46.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	531	70.38
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	132	15.42
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	60	12.92
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	8398	619.44
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	246	102.87
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	37	37.83
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	998	251.2
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	774	219.37
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	2247	574.87
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	939	452.31
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	439	364.69
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	2136	1211.12
S0708	Solanum lycopersicum	MicroTom	flower, open	2134	658.43
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	3240	850.59
S0373	Solanum lycopersicum	Heinz 1706	fruit	3308	990.13
S0372	Solanum lycopersicum	Heinz 1706	flower	4498	1361.28
S0371	Solanum lycopersicum	Heinz 1706	leaf	2806	845.56