Tomato sRNA S01117107
| Sequence | Length | annotation |
| AAAGUUGACGGCGUUAGAUUGAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 20 | 1.48 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 123 | 94.79 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 74 | 56.14 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 51 | 36.33 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 79 | 58.18 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 122 | 76.18 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 62 | 39.5 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 76 | 50.09 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 81 | 49.52 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 80 | 47.89 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 193 | 188.31 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 252 | 147.11 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 198 | 194.23 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 227 | 160.54 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 128 | 139.34 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 282 | 269.44 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 228 | 658.63 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 68 | 47.37 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 148 | 197.5 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 61 | 25.51 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 35 | 35.79 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 66 | 16.61 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 77 | 21.82 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 39 | 9.98 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 15 | 7.23 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 44 | 13.58 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 85 | 22.31 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|