Tomato sRNA S02465474
| Sequence | Length | annotation |
|---|
| AAGAUAGACUUGUUUGACUCUUGA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 28 | 2.07 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 18 | 13.87 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 3 | 2.21 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 30 | 19.11 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 28 | 18.45 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 13 | 7.95 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 20 | 11.97 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 77 | 75.13 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 227 | 132.52 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 108 | 105.94 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 137 | 96.89 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 47 | 51.16 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 70 | 66.88 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5 | 14.44 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 23 | 16.02 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6 | 8.01 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1 | 0.28 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 13 | 7.37 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 25 | 7.71 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 65 | 17.06 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 |
|
