Tomato Functional Genomics Database (TFGD)

Tomato sRNA S02673882

Sequence	Length	annotation
AAGCUGACGGCAUUAGAUUGAUAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1	0.07
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	14	10.79
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	33	25.03
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	21	14.96
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	18	13.26
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	20	12.49
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	12	7.64
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	15	9.89
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	27	16.51
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	20	11.97
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	38	37.08
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	49	28.6
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	29	28.45
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	15	10.61
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	30	32.66
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	49	46.82
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	48	138.66
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	16	11.15
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	17	22.69
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	15	6.27
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	15	3.78
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	24	6.8
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	19	4.86
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	11	5.3
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	16	13.29
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	10	5.67
S0708	Solanum lycopersicum	MicroTom	flower, open	16	4.94
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	53	13.91