Tomato sRNA S02673912
Sequence | Length | annotation |
AAGCUGACGGCGUUAGAUUGAUAU | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 6 | 0.44 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 59 | 45.47 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 23 | 17.45 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 23 | 16.39 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 27 | 19.88 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 50 | 31.22 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 32 | 20.39 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 37 | 24.38 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 39 | 23.84 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 38 | 22.75 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 159 | 155.14 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 141 | 82.31 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 240 | 235.42 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 166 | 117.4 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 68 | 74.02 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 194 | 185.36 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 172 | 496.86 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 22 | 15.33 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 48 | 64.05 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 12 | 5.02 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 6 | 6.14 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 12 | 3.02 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 19 | 5.39 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 18 | 4.61 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 19 | 9.15 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 19 | 5.86 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 69 | 18.11 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|