Tomato Functional Genomics Database (TFGD)

Tomato sRNA S02673912

Sequence	Length	annotation
AAGCUGACGGCGUUAGAUUGAUAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	6	0.44
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	59	45.47
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	23	17.45
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	23	16.39
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	27	19.88
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	50	31.22
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	32	20.39
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	37	24.38
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	39	23.84
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	38	22.75
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	159	155.14
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	141	82.31
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	240	235.42
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	166	117.4
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	68	74.02
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	194	185.36
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	172	496.86
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	22	15.33
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	48	64.05
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	12	5.02
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	6	6.14
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	12	3.02
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	19	5.39
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	18	4.61
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	19	9.15
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	2	1.66
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	11	6.24
S0708	Solanum lycopersicum	MicroTom	flower, open	19	5.86
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	69	18.11
S0372	Solanum lycopersicum	Heinz 1706	flower	3	0.91
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3