Tomato Functional Genomics Database (TFGD)

Tomato sRNA S02840588

Sequence	Length	annotation
AAGGGAUUGUAGGCAGAGAGAUGG	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3	0.65
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	24	1.77
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	163	125.61
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	23	17.45
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	93	66.26
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	122	89.85
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	139	86.79
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	65	41.41
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	93	61.29
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	164	100.26
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	174	104.16
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	37	36.1
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	34	19.85
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	17	16.68
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	50	35.36
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	62	67.49
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	35	33.44
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	21	60.66
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	21	14.63
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	72	96.08
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	15	6.27
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	5	5.11
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	24	6.04
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	77	21.82
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	48	12.28
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	187	90.08
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	351	291.59
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	738	418.45
S0708	Solanum lycopersicum	MicroTom	flower, open	75	23.14
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	172	45.15