Tomato sRNA S02840588
Sequence | Length | annotation |
AAGGGAUUGUAGGCAGAGAGAUGG | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 24 | 1.77 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 163 | 125.61 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 23 | 17.45 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 93 | 66.26 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 122 | 89.85 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 139 | 86.79 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 65 | 41.41 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 93 | 61.29 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 164 | 100.26 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 174 | 104.16 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 37 | 36.1 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 34 | 19.85 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 17 | 16.68 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 50 | 35.36 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 62 | 67.49 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 35 | 33.44 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 21 | 60.66 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 21 | 14.63 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 72 | 96.08 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 15 | 6.27 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 24 | 6.04 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 77 | 21.82 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 48 | 12.28 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 187 | 90.08 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 351 | 291.59 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 738 | 418.45 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 75 | 23.14 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 172 | 45.15 |
|