Tomato sRNA S03156022
Sequence | Length | annotation |
AAGUUGACGGCGUUAGAUUGAUA | 23 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 2 | 0.27 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 10 | 0.74 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 180 | 138.71 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 112 | 84.96 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 64 | 45.6 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 116 | 85.43 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 186 | 116.14 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 105 | 66.89 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 131 | 86.34 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 124 | 75.81 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 144 | 86.2 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 181 | 176.6 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 265 | 154.7 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 155 | 152.05 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 192 | 135.79 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 151 | 164.38 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 224 | 214.02 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 256 | 739.51 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 70 | 48.76 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 200 | 266.89 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 185 | 77.36 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 32 | 32.72 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 180 | 45.31 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 198 | 56.12 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 131 | 33.52 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 37 | 17.82 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 18 | 14.95 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 23 | 13.04 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 66 | 20.36 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 124 | 32.55 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|