Tomato Functional Genomics Database (TFGD)

Tomato sRNA S03156023

Sequence	Length	annotation
AAGUUGACGGCGUUAGAUUGAUAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	7	0.52
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	86	66.27
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	84	63.72
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	68	48.45
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	90	66.28
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	114	71.18
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	65	41.41
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	80	52.72
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	80	48.91
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	78	46.69
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	101	98.55
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	137	79.98
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	105	103
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	181	128.01
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	100	108.86
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	218	208.29
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	138	398.64
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	84	58.52
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	146	194.83
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	46	19.24
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	17	17.38
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	48	12.08
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	28	7.94
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	27	6.91
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	13	6.26
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	6	4.98
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	23	13.04
S0708	Solanum lycopersicum	MicroTom	flower, open	32	9.87
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	101	26.52
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0371	Solanum lycopersicum	Heinz 1706	leaf	2	0.6