Tomato Functional Genomics Database (TFGD)

Tomato sRNA S04774071

Sequence	Length	annotation
ACAUGGCAGGAAGACAUGAGGCAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	113	87.08
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	46	34.9
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	42	29.92
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	87	64.07
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	110	68.68
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	106	67.53
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	131	86.34
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	149	91.09
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	213	127.5
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	21	20.49
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	125	72.97
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	28	27.47
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	66	46.68
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	15	16.33
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	1	0.96
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	44	30.65
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	33	44.04
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	3	1.25
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	12	12.27
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	14	3.52
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	9	2.55
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	27	6.91
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	74	35.65
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	65	54
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	94	53.3
S0708	Solanum lycopersicum	MicroTom	flower, open	34	10.49
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	298	78.23
S0372	Solanum lycopersicum	Heinz 1706	flower	2	0.61

S04774071 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc00g144470	1190	1213	+	click here
Solyc02g067130	995	1018	+	click here
Solyc06g035480	1064	1087	+	click here
Solyc08g066370	1343	1366	+	click here
Solyc09g061650	575	598	+	click here