Tomato sRNA S04774071
Sequence | Length | annotation |
ACAUGGCAGGAAGACAUGAGGCAU | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 113 | 87.08 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 46 | 34.9 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 42 | 29.92 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 87 | 64.07 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 110 | 68.68 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 106 | 67.53 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 131 | 86.34 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 149 | 91.09 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 213 | 127.5 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 21 | 20.49 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 125 | 72.97 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 28 | 27.47 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 66 | 46.68 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 15 | 16.33 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 44 | 30.65 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 33 | 44.04 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 3 | 1.25 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 12 | 12.27 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 14 | 3.52 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 9 | 2.55 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 27 | 6.91 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 74 | 35.65 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 65 | 54 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 94 | 53.3 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 34 | 10.49 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 298 | 78.23 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 |
S04774071 mapped to the follwoing genes
|