Tomato sRNA S04789486
| Sequence | Length | annotation |
| ACAUGUGGGACCAGCGCGGAGUGA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 6 | 0.7 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 21 | 4.52 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 5918 | 436.51 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1 | 0.74 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 1 | 0.62 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 1 | 1.33 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 9 | 2.27 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 11 | 3.12 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 9 | 2.3 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 6 | 1.8 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 5 | 1.51 |
|