Tomato sRNA S06063220
| Sequence | Length | annotation |
| AGAAGGGGAGAUAGAUGAAGU | 21 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 4 | 0.53 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 6 | 0.7 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1 | 0.07 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 37 | 15.47 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 82 | 20.64 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 7 | 1.98 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 22 | 5.63 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 7 | 3.37 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 5 | 2.84 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2 | 0.53 |
|