Tomato sRNA S06121010
Sequence | Length | annotation |
AGAAUAGUUGGCUCAUUAGGUUAA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 41 | 4.79 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 6 | 1.29 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 69 | 5.09 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 2 | 1.54 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 1 | 0.76 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 7 | 4.99 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 7 | 5.16 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 2 | 1.25 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 6 | 3.82 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 6 | 3.95 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 42 | 40.98 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 41 | 23.93 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 10 | 7.07 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 55 | 59.87 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 208 | 198.73 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 10 | 28.89 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 3 | 0.76 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 4 | 1.02 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 72 | 22.22 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 13 | 3.41 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 16 | 4.79 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 28 | 8.47 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 26 | 7.83 |
|