Tomato sRNA S06164317
Sequence | Length | annotation |
AGAAUGUUGUCUGGUUCGAAA | 21 | |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 6 | 0.58 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 75 | 8.76 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 26 | 5.6 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 268 | 19.77 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2 | 0.62 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 19 | 5.69 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 111 | 33.59 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 261 | 78.65 |
|