Tomato Functional Genomics Database (TFGD)

Tomato sRNA S06206896

Sequence	Length	annotation
AGACAAGCAAAUUGAAACGGACUG	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	4	0.39
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	4	0.53
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	173	12.76
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	302	232.73
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	137	103.93
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	113	80.51
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	151	111.21
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	181	113.02
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	191	121.68
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	153	100.83
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	140	85.59
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	212	126.91
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	13	12.68
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	30	17.51
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	38	26.87
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	77	83.82
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	2	1.91
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	140	97.53
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	19	25.35
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	2	0.5
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	8	2.27
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	10	2.56
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	7	3.37
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	2	1.13
S0708	Solanum lycopersicum	MicroTom	flower, open	18	5.55
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	16	4.2
S0373	Solanum lycopersicum	Heinz 1706	fruit	7	2.1
S0372	Solanum lycopersicum	Heinz 1706	flower	15	4.54
S0371	Solanum lycopersicum	Heinz 1706	leaf	11	3.31