Tomato sRNA S06434920

SequenceLengthannotation
AGAGACAAUACCUGAAUAUGUGAA24miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)40.39
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)30.4
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)10.12
S0735Solanum lycopersicumSunnyleaf , TSWV-infected886.49
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 75.39
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 1511.38
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 74.99
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 21.47
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 106.24
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 117.01
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 42.64
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 10.61
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 21.2
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate36159.52
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate29153.12
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate1136133.41
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate23121.92
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate16570.76
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate2188179.63
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate136103.99
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate21510.45
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate134
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker83.35
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker215.29
S0713Solanum lycopersicumMicroTom fruit , breaker stage133.68
S0712Solanum lycopersicumMicroTom fruit , mature green328.19
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter94.34
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter64.98
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter158.51
S0708Solanum lycopersicumMicroTom flower, open4714.5
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming277.09
S0373Solanum lycopersicumHeinz 1706fruit247.18
S0372Solanum lycopersicumHeinz 1706flower298.78
S0371Solanum lycopersicumHeinz 1706leaf185.42

S06434920 mapped to the follwoing genes

gene IDstart positionstop positionstrandexpression
Solyc05g031610629+click here