Tomato Functional Genomics Database (TFGD)

Tomato sRNA S06454254

Sequence	Length	annotation
AGAGACGCACUUAUACUAUACUAA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	2	0.27
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	5	0.37
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	23	17.72
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	12	9.1
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	20	14.25
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	17	12.52
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	23	14.36
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	26	16.56
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	8	5.27
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	36	22.01
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	27	16.16
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	33	32.2
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	73	42.62
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	31	30.41
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	33	23.34
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	45	48.99
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	40	38.22
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	65	187.77
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	31	21.6
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	31	41.37
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	25	6.29
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	8	2.27
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	17	4.35
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	9	4.34
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	8	6.65
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	15	8.51
S0708	Solanum lycopersicum	MicroTom	flower, open	68	20.98
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	82	21.53
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0372	Solanum lycopersicum	Heinz 1706	flower	2	0.61