Tomato sRNA S06456488
Sequence | Length | annotation |
AGAGACGGACUUAUACUAUACUAA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 15 | 1.11 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 124 | 51.85 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 18 | 18.41 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 152 | 38.26 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 179 | 50.73 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 170 | 43.49 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 62 | 29.87 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 67 | 55.66 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 89 | 50.46 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 345 | 106.45 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 332 | 87.16 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 6 | 1.81 |
|