Tomato sRNA S06611281
Sequence | Length | annotation |
AGAGGACGGUCUGAGAGAGUUUUA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 33 | 25.43 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 18 | 13.65 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 46 | 32.77 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 51 | 37.56 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 34 | 21.23 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 35 | 22.3 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 44 | 29 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 44 | 26.9 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 47 | 28.13 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 9 | 8.78 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 15 | 8.76 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 17 | 16.68 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 3 | 2.12 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 30 | 32.66 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 11 | 10.51 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 125 | 87.08 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 88 | 117.43 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 44 | 18.4 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 33 | 33.74 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 103 | 25.93 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 178 | 50.45 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 97 | 24.82 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 80 | 38.54 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 65 | 54 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 35 | 19.85 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 50 | 15.43 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 140 | 36.75 |
|