Tomato Functional Genomics Database (TFGD)

Tomato sRNA S06611281

Sequence	Length	annotation
AGAGGACGGUCUGAGAGAGUUUUA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2	0.15
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	33	25.43
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	18	13.65
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	46	32.77
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	51	37.56
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	34	21.23
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	35	22.3
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	44	29
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	44	26.9
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	47	28.13
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	9	8.78
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	15	8.76
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	17	16.68
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	3	2.12
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	30	32.66
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	11	10.51
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	125	87.08
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	88	117.43
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	44	18.4
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	33	33.74
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	103	25.93
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	178	50.45
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	97	24.82
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	80	38.54
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	65	54
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	35	19.85
S0708	Solanum lycopersicum	MicroTom	flower, open	50	15.43
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	140	36.75