Tomato sRNA S06648170
Sequence | Length | annotation |
AGAGGCGGAGUCAGAAUUUUCAAU | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 22 | 2.92 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 12 | 1.4 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 264 | 19.47 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 1070 | 824.56 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 1284 | 974.05 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 1971 | 1404.21 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 2830 | 2084.23 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 1761 | 1099.58 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1337 | 851.73 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 1989 | 1310.85 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 1286 | 786.19 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 1443 | 863.8 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 246 | 240.02 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 283 | 165.21 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 277 | 271.72 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 525 | 371.3 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 839 | 913.34 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1390 | 1328.08 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 771 | 2227.21 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 2993 | 2085.05 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 2537 | 3385.46 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 800 | 334.53 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 215 | 219.85 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1254 | 315.64 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1438 | 407.56 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1379 | 352.8 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 479 | 230.73 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 318 | 264.18 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 559 | 316.95 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 312 | 96.27 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 572 | 150.17 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 31 | 9.38 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 16 | 4.82 |
|