Tomato sRNA S07306443
Sequence | Length | annotation |
AGCUGACGGCGUUAGAUUGAUAUA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 15 | 1.11 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 416 | 320.58 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 161 | 122.14 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 184 | 131.09 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 200 | 147.3 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 363 | 226.66 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 219 | 139.51 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 221 | 145.65 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 270 | 165.06 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 249 | 149.05 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 479 | 467.36 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 453 | 264.45 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 415 | 407.09 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 758 | 536.08 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 363 | 395.16 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1022 | 976.48 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 499 | 1441.48 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 214 | 149.08 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 297 | 396.33 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 32 | 13.38 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 16 | 16.36 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 58 | 14.6 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 92 | 26.07 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 101 | 25.84 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 29 | 13.97 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 10 | 8.31 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 45 | 25.52 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 138 | 42.58 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 208 | 54.61 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|