Tomato sRNA S07733087
Sequence | Length | annotation |
AGGCGCAUGUGUCAUAUCUUUACA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3 | 0.29 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 17 | 2.25 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 99 | 11.57 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 35 | 7.54 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 686 | 50.6 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 15 | 11.56 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 12 | 8.55 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 6 | 4.42 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 14 | 8.74 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 13 | 8.28 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 29 | 19.11 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 8 | 4.89 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 11 | 6.58 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 48 | 46.83 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 54 | 31.52 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 61 | 59.84 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 63 | 44.56 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 64 | 69.67 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 169 | 161.47 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 7 | 20.22 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 30 | 20.9 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 7 | 9.34 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 22 | 9.2 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 29 | 7.3 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 42 | 11.9 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 52 | 13.3 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 26 | 12.52 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 12 | 9.97 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 37 | 20.98 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 386 | 119.1 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 119 | 31.24 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 121 | 36.22 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 148 | 44.79 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 31 | 9.34 |
|