Tomato sRNA S07846777
| Sequence | Length | annotation |
|---|
| AGGGAUUGUAGGCAGAGAGA | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 21 | 1.55 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 34 | 26.2 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 9 | 6.83 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 15 | 10.69 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 27 | 19.88 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 40 | 24.98 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 20 | 12.74 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 22 | 14.5 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 27 | 16.51 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 25 | 14.97 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 6 | 5.85 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 9 | 5.25 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 8 | 7.85 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 13 | 9.19 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 14 | 15.24 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 8 | 7.64 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5 | 14.44 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 13 | 9.06 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 7 | 9.34 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 46 | 19.24 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 95 | 23.91 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 104 | 29.48 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 121 | 30.96 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 384 | 184.97 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 501 | 416.2 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1073 | 608.39 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 95 | 29.31 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 279 | 73.25 |
|
