Tomato Functional Genomics Database (TFGD)

Tomato sRNA S07846779

Sequence	Length	annotation
AGGGAUUGUAGGCAGAGAGAUG	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2	0.43
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	89	6.56
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	92	70.9
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	9	6.83
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	13	9.26
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	130	95.74
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	38	23.73
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	14	8.92
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	54	35.59
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	94	57.47
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	33	19.75
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	4	3.9
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	8	4.67
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	5	4.9
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	10	7.07
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	38	41.37
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	16	15.29
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	10	28.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	44	30.65
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	60	80.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	153	63.98
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	117	119.64
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	305	76.77
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	774	219.37
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	389	99.52
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	784	377.65
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	1234	1025.13
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	2518	1427.71
S0708	Solanum lycopersicum	MicroTom	flower, open	311	95.96
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	924	242.57