Tomato sRNA S07846781
Sequence | Length | annotation |
AGGGAUUGUAGGCAGAGAGAUGGC | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 188 | 18.32 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 94 | 12.46 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 32 | 3.74 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 294 | 63.31 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3519 | 259.56 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 12644 | 9743.65 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 1875 | 1422.39 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 6507 | 4635.82 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 10817 | 7966.47 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 9286 | 5798.24 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 4531 | 2886.44 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 5440 | 3585.23 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 10324 | 6311.55 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 10887 | 6517.1 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 1395 | 1361.1 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 1881 | 1098.08 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 943 | 925.02 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 3959 | 2799.93 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5087 | 5537.72 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1550 | 1480.96 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 827 | 2388.98 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 5499 | 3830.83 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6333 | 8450.97 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2362 | 987.7 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3869 | 3956.25 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 4756 | 1197.11 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 13857 | 3927.4 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 7016 | 1794.97 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 13333 | 6422.48 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 22027 | 18298.7 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 42482 | 24087.4 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4730 | 1459.41 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 11896 | 3123.02 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 103 | 30.83 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 42 | 12.71 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 61 | 18.38 |
|