Tomato sRNA S08090164
| Sequence | Length | annotation |
| AGGUGUCUAGAUGUGCAUACUCAA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 32 | 3.74 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 27 | 1.99 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 12 | 9.25 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 8 | 6.07 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 32 | 22.8 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 28 | 20.62 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 34 | 21.23 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 10 | 6.37 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 13 | 7.95 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 13 | 7.78 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 49 | 47.81 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 114 | 66.55 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 45 | 44.14 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 153 | 108.21 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 30 | 32.66 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 83 | 79.3 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 9 | 26 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 19 | 13.24 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 4 | 5.34 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 5 | 1.42 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 10 | 3.09 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 5 | 1.31 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 9 | 2.72 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 8 | 2.41 |
|