Tomato Functional Genomics Database (TFGD)

Tomato sRNA S08410667

Sequence	Length	annotation
AGUGAAGGGCAUAUAUACUCUAGU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	5	0.49
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	14	1.86
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2	0.43
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	12	0.89
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	207	159.52
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	259	196.48
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	251	178.82
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	300	220.94
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	302	188.57
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	234	149.07
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	243	160.15
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	311	190.13
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	263	157.44
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	138	134.65
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	192	112.08
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	27	26.49
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	93	65.77
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	92	100.15
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	50	47.77
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	29	83.77
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	173	120.52
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	154	205.5
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	36	15.05
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	57	14.35
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	42	11.9
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	51	13.05
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	11	5.3
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	26	21.6
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	16	9.07
S0708	Solanum lycopersicum	MicroTom	flower, open	78	24.07
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	86	22.58
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0372	Solanum lycopersicum	Heinz 1706	flower	3	0.91
S0371	Solanum lycopersicum	Heinz 1706	leaf	2	0.6