Tomato sRNA S08410667
| Sequence | Length | annotation |
| AGUGAAGGGCAUAUAUACUCUAGU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 14 | 1.86 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 12 | 0.89 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 207 | 159.52 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 259 | 196.48 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 251 | 178.82 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 300 | 220.94 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 302 | 188.57 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 234 | 149.07 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 243 | 160.15 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 311 | 190.13 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 263 | 157.44 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 138 | 134.65 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 192 | 112.08 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 27 | 26.49 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 93 | 65.77 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 92 | 100.15 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 50 | 47.77 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 29 | 83.77 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 173 | 120.52 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 154 | 205.5 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 36 | 15.05 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 57 | 14.35 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 42 | 11.9 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 51 | 13.05 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 26 | 21.6 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 16 | 9.07 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 78 | 24.07 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 86 | 22.58 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
|