Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AGUUGACGGCGUUAAAUUGAUAUA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2	0.15
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	106	44.33
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	25	25.56
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	71	17.87
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	155	43.93
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	183	46.82
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	59	28.42
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	44	36.55
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	111	62.94
S0708	Solanum lycopersicum	MicroTom	flower, open	286	88.24
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	454	119.19
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3