Tomato sRNA S08637549
Sequence | Length | annotation |
AGUUGACGGCGUUAGAUUGAUA | 22 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 24 | 18.49 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 19 | 14.41 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 11 | 7.84 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 12 | 8.84 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 23 | 14.36 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 5 | 3.19 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 11 | 7.25 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 20 | 12.23 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 23 | 13.77 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 11 | 10.73 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 19 | 11.09 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 20 | 14.14 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 17 | 18.51 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 42 | 40.13 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 35 | 101.11 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 14 | 9.75 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 15 | 20.02 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 40 | 16.73 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 7 | 7.16 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 40 | 10.07 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 45 | 12.75 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 58 | 14.84 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 16 | 7.71 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 22 | 12.47 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 42 | 12.96 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 86 | 22.58 |
|